Stem-loop sequence gga-mir-20b

AccessionMI0001517 (change log)
DescriptionGallus gallus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

8 open access papers mention gga-mir-20b
(41 sentences)

Stem-loop
   ------          -ca           g     g   c  gg 
5'       cuagcaguau   aagugcucaua ugcag uag uu  c
         ||||||||||   ||||||||||| ||||| ||| ||  a
3'       gauugucaug   uucacgggugu auguc auc ag  u
   gaaaua          aca           a     -   c  gu 
Get sequence
Deep sequencing
20948 reads, 420 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 3994839-3994923 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-20b
gga-mir-106chr4: 3995151-3995231 [-]
gga-mir-18bchr4: 3995020-3995103 [-]
gga-mir-20bchr4: 3994839-3994923 [-]
gga-mir-19b-2chr4: 3994707-3994789 [-]
gga-mir-92-2chr4: 3994560-3994640 [-]
gga-mir-363chr4: 3994409-3994515 [-]
Database links

Mature sequence gga-miR-20b-5p

Accession MIMAT0001411
Sequence

11 - 

caaagugcucauagugcagguag

 - 33

Get sequence
Deep sequencing20904 reads, 5 experiments
Evidence experimental; cloned [2], Illumina [3]
Predicted targets

Mature sequence gga-miR-20b-3p

Accession MIMAT0026551
Sequence

49 - 

acuguaaugugggcacuuacag

 - 70

Get sequence
Deep sequencing43 reads, 5 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:15590942 "Transcriptome analysis for the chicken based on 19,626 finished cDNA sequences and 485,337 expressed sequence tags" Hubbard SJ, Grafham DV, Beattie KJ, Overton IM, McLaren SR, Croning MD, Boardman PE, Bonfield JK, Burnside J, Davies RM, Farrell ER, Francis MD, Griffiths-Jones S, Humphray SJ, Hyland C, Scott CE, Tang H, Taylor RG, Tickle C, Brown WR, Birney E, Rogers J, Genome Res. 15:174-183(2005).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).