Stem-loop sequence sbi-MIR160e

AccessionMI0001511 (change log)
DescriptionSorghum bicolor miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention sbi-MIR160e
(11 sentences)

Stem-loop
   u  c    u  c         cu    -        acccca     au 
5'  gc uggc cc uguaugcca  cgca cggcuacc      agauc  c
    || |||| || |||||||||  |||| ||||||||      |||||  g
3'  cg accg gg gcgugcggu  gcgu gccggugg      ucuag  a
   a  a    u  a         cg    c        -----c     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 2883714-2883808 [-]
intergenic
Database links

Mature sequence sbi-miR160e

Accession MIMAT0001405
Sequence

1 - 

ugccuggcucccuguaugcca

 - 21

Get sequence
Evidence by similarity; MI0000190

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).