Stem-loop sequence sbi-MIR160b

AccessionMI0001510 (change log)
DescriptionSorghum bicolor miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention sbi-MIR160b
(12 sentences)

Stem-loop
   u  c       c          acauguagcccaacccgu 
5'  gc uggcucc uguaugccac                  g
    || ||||||| ||||||||||                   
3'  cg accgagg acgugcggug                  g
   a  a       a          ggugucguagguuagugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 57093822-57093903 [+]
intergenic
Database links

Mature sequence sbi-miR160b

Accession MIMAT0001404
Sequence

1 - 

ugccuggcucccuguaugcca

 - 21

Get sequence
Evidence by similarity; MI0000192

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).