Stem-loop sequence sbi-MIR160c

AccessionMI0001509 (change log)
DescriptionSorghum bicolor miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention sbi-MIR160c
(11 sentences)

Stem-loop
   u  c    u  c         cu    -   aucaa      c 
5'  gc uggc cc uguaugcca  cauc uag     caacua c
    || |||| || |||||||||  |||| |||     ||||||  
3'  cg accg gg acgugcggu  guag auc     guuggu u
   a  a    u  c         ug    u   ----c      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 2618794-2618876 [+]
intergenic
Database links

Mature sequence sbi-miR160c

Accession MIMAT0001403
Sequence

1 - 

ugccuggcucccuguaugcca

 - 21

Get sequence
Evidence by similarity; MI0000190

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).