Stem-loop sequence sbi-MIR160a

AccessionMI0001508 (change log)
DescriptionSorghum bicolor miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

3 open access papers mention sbi-MIR160a
(13 sentences)

Stem-loop
   u  c       c          a   -    cc     caua 
5'  gc uggcucc uguaugccac cau guag  caacc    u
    || ||||||| |||||||||| ||| ||||  |||||     
3'  cg accgggg acgugcggug gug cguc  guugg    g
   a  a       a          g   u    -c     aauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 4215241-4215324 [-]
intergenic
Database links

Mature sequence sbi-miR160a

Accession MIMAT0001402
Sequence

1 - 

ugccuggcucccuguaugcca

 - 21

Get sequence
Evidence by similarity; MI0000192

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).