Stem-loop sequence sbi-MIR172a

AccessionMI0001503 (change log)
DescriptionSorghum bicolor miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

6 open access papers mention sbi-MIR172a
(34 sentences)

Stem-loop
                       a    cagc     cu ggug      -     ac 
5' gugcagcaucaucaagauuc cauc    ucauc  c    auaugc uauau  a
   |||||||||||||||||||| ||||    |||||  |    |||||| |||||   
3' uacgucguaguaguucuaag guag    aguag  g    uaugcg auaua  u
                       a    ----     -u ----      u     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 58774558-58774659 [-]
intergenic
Database links

Mature sequence sbi-miR172a

Accession MIMAT0001397
Sequence

82 - 

agaaucuugaugaugcugca

 - 101

Get sequence
Evidence by similarity; MI0000215

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).