Stem-loop sequence sbi-MIR172c

AccessionMI0001502 (change log)
DescriptionSorghum bicolor miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention sbi-MIR172c
(37 sentences)

Stem-loop
           c           a   gguccaacucaugcaucuucagugaugcucaugu 
5' gugcagca caucaagauuc cau                                  g
   |||||||| ||||||||||| |||                                  a
3' uacgucgu guaguucuaag gua                                  u
           a           a   gaguaguguauacguauauaucguugacgcucgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 67645991-67646109 [-]
intergenic
Database links

Mature sequence sbi-miR172c

Accession MIMAT0001396
Sequence

99 - 

agaaucuugaugaugcugca

 - 118

Get sequence
Evidence by similarity; MI0000216

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).