Stem-loop sequence sbi-MIR172b

AccessionMI0001501 (change log)
DescriptionSorghum bicolor miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention sbi-MIR172b
(30 sentences)

Stem-loop
   gc ug               a     ugcuugcaaaugcauacaugcaucucugccgccuucuuugccugccauuaauagcagu 
5'   g  gcaucaucaagauuc cacac                                                          u
     |  ||||||||||||||| |||||                                                           
3'   c  cguaguaguucuaag gugug                                                          u
   ua gu               g     uauguguauauauaagugucuccguauauacuacgucgucgucgauuuuguacaucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr3: 74188339-74188508 [-]
intergenic
Database links

Mature sequence sbi-miR172b

Accession MIMAT0001395
Sequence

150 - 

ggaaucuugaugaugcugca

 - 169

Get sequence
Evidence by similarity; MI0000216

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).