|
miRBase |
|
Stem-loop sequence zma-MIR172c |
|||||
| Accession | MI0001496 | ||||
| Description | Zea mays miR172c stem-loop | ||||
| Gene family | MIPF0000035; MIR172 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin. |
||||
| Stem-loop |
c c a - acuc gcaucuucagugaugcaugcaugcucu gugcagca ca caagauuc cauc ca ucac g |||||||| || |||||||| |||| || |||| uacgucgu gu guucuaag guag gu agug u a a a a ---- uauacguauaucgacgacgcucuguag |
||||
| Genome context |
|
||||
Mature sequence zma-miR172c-5p |
|
| Accession | MIMAT0015158 |
| Previous IDs | zma-miR172c* |
| Sequence |
4 - cagcaccaccaagauucaca - 23 |
| Evidence | experimental; Solexa [2] |
Mature sequence zma-miR172c-3p |
|
| Accession | MIMAT0001390 |
| Previous IDs | zma-miR172c |
| Sequence |
103 - agaaucuugaugaugcugca - 122 |
| Evidence | experimental; Solexa [2] |
References |
|
| 1 |
"Identifying microRNAs in plant genomes"
Proc IEEE CSB :718-723(2004).
|
| 2 |
PMID:19936050
"A genome-wide characterization of microRNA genes in maize"
PLoS Genet. 5:e1000716(2009).
|