Stem-loop sequence zma-MIR172c

AccessionMI0001496 (change log)
DescriptionZea mays miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

37 open access papers mention zma-MIR172c
(224 sentences)

Stem-loop
           c  c        a    -  acuc    gcaucuucagugaugcaugcaugcucu 
5' gugcagca ca caagauuc cauc ca    ucac                           g
   |||||||| || |||||||| |||| ||    ||||                            
3' uacgucgu gu guucuaag guag gu    agug                           u
           a  a        a    a  ----    uauacguauaucgacgacgcucuguag 
Get sequence
Deep sequencing
2501 reads, 365 reads per million, 119 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 174154928-174155050 [+]
intergenic
Database links

Mature sequence zma-miR172c-5p

Accession MIMAT0015158
Previous IDszma-miR172c*
Sequence

4 - 

cagcaccaccaagauucaca

 - 23

Get sequence
Deep sequencing11 reads, 4 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR172c-3p

Accession MIMAT0001390
Previous IDszma-miR172c
Sequence

103 - 

agaaucuugaugaugcugca

 - 122

Get sequence
Deep sequencing2359 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).