Stem-loop sequence zma-MIR172c

Accession MI0001496
Description Zea mays miR172c stem-loop
Gene family MIPF0000035; MIR172
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-172_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-172 microRNA is thought to target mRNAs coding for APETALA2-like transcription factors. It has been verified experimentally in the model plant, Arabidopsis thaliana (mouse-ear cress). The mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        c  c        a    -  acuc    gcaucuucagugaugcaugcaugcucu 
gugcagca ca caagauuc cauc ca    ucac                           g
|||||||| || |||||||| |||| ||    ||||                            
uacgucgu gu guucuaag guag gu    agug                           u
        a  a        a    a  ----    uauacguauaucgacgacgcucuguag 
Get sequence
Genome context
Coordinates (RefGen_v2) Overlapping transcripts
chr4: 171126410-171126532 [+]
intergenic

Mature sequence zma-miR172c-5p

Accession MIMAT0015158
Previous IDs zma-miR172c*
Sequence

4 - 

cagcaccaccaagauucaca

 - 23

Get sequence
Evidence experimental; Solexa [2]

Mature sequence zma-miR172c-3p

Accession MIMAT0001390
Previous IDs zma-miR172c
Sequence

103 - 

agaaucuugaugaugcugca

 - 122

Get sequence
Evidence experimental; Solexa [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).