Stem-loop sequence zma-MIR172b

AccessionMI0001495 (change log)
DescriptionZea mays miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

37 open access papers mention zma-MIR172b
(249 sentences)

Stem-loop
           c           a    guccaacucaug       c          cuu  aug     u 
5' gugcagca caucaagauuc cauc            caucaug auauaugcau   ca   augcg g
   |||||||| ||||||||||| ||||            ||||||| ||||||||||   ||   ||||| c
3' uacgucgu guaguucuaag guag            guaguau uauauaugug   gu   uacgc c
           a           a    -----------a       a          --u  --g     u 
Get sequence
Deep sequencing
2376 reads, 1.92e+03 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 221721349-221721474 [-]
intergenic
Database links

Mature sequence zma-miR172b-5p

Accession MIMAT0015157
Previous IDszma-miR172b*
Sequence

4 - 

cagcaccaucaagauucaca

 - 23

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR172b-3p

Accession MIMAT0001389
Previous IDszma-miR172b
Sequence

106 - 

agaaucuugaugaugcugca

 - 125

Get sequence
Deep sequencing2359 reads, 5 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).