Stem-loop sequence zma-MIR172d

AccessionMI0001494 (change log)
DescriptionZea mays miR172d stem-loop
Gene family MIPF0000035; MIR172
Literature search

36 open access papers mention zma-MIR172d
(207 sentences)

Stem-loop
           c           a    - -c  -  u g 
5' gugcagca caucaagauuc cauc c  ca gc c a
   |||||||| ||||||||||| |||| |  || || | u
3' uacgucgu guaguucuaag guag g  gu cg g c
           a           a    a ua  a  u u 
Get sequence
Deep sequencing
2385 reads, 2.52e+03 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 172029786-172029859 [+]
intergenic
Database links

Mature sequence zma-miR172d-5p

Accession MIMAT0015156
Previous IDszma-miR172d*
Sequence

4 - 

cagcaccaucaagauucaca

 - 23

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR172d-3p

Accession MIMAT0001388
Previous IDszma-miR172d
Sequence

54 - 

agaaucuugaugaugcugca

 - 73

Get sequence
Deep sequencing2359 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).