Stem-loop sequence zma-MIR172a

AccessionMI0001493 (change log)
DescriptionZea mays miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

38 open access papers mention zma-MIR172a
(222 sentences)

Stem-loop
   gc ug               a  acc   -  a      cc 
5'   g  gcaucaucaagauuc ca   cau ca uccgaa  a
     |  ||||||||||||||| ||   ||| || ||||||  c
3'   c  cguaguaguucuaag gu   gua gu agguuu  u
   ua gu               a  -ay   c  a      ag 
Get sequence
Deep sequencing
2374 reads, 2.08e+03 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 54276707-54276789 [-]
intergenic
Database links

Mature sequence zma-miR172a

Accession MIMAT0001387
Sequence

63 - 

agaaucuugaugaugcugca

 - 82

Get sequence
Deep sequencing2355 reads, 4 experiments
Evidence by similarity; MI0000216

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).