Stem-loop sequence zma-MIR171b

AccessionMI0001492 (change log)
DescriptionZea mays miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

21 open access papers mention zma-MIR171b
(64 sentences)

Stem-loop
     g                       a  cuu c     agg 
5' cg gauauuggcgcgguucaaucaga ag   g gcucc   c
   || ||||||||||||||||||||||| ||   | |||||    
3' gc cuauaaccgugccgaguuaguuu uc   c cgggg   c
     a                       c  -ac u     agc 
Get sequence
Deep sequencing
2419 reads, 862 reads per million, 177 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 223360741-223360825 [-]
intergenic
chr10: 143745137-143745221 [-]
intergenic
Database links

Mature sequence zma-miR171b-5p

Accession MIMAT0015155
Previous IDszma-miR171b*
Sequence

4 - 

gauauuggcgcgguucaauc

 - 23

Get sequence
Deep sequencing90 reads, 32 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR171b-3p

Accession MIMAT0001386
Previous IDszma-miR171b
Sequence

65 - 

uugagccgugccaauaucac

 - 84

Get sequence
Deep sequencing2114 reads, 166 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).