Stem-loop sequence zma-MIR171a

AccessionMI0001491 (change log)
DescriptionZea mays miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

20 open access papers mention zma-MIR171a
(52 sentences)

             a             gauguauuuuucuuauauauaaau 
5' gauauuggcg gguucaaucagau                        u
   |||||||||| |||||||||||||                        u
3' cuauaaccgc ccgaguuagucug                        g
             g             ugaccuaaguguggaaguacguac 
Get sequence
Deep sequencing
2298 reads, 477 reads per million, 130 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 239713555-239713653 [+]
Database links

Mature sequence zma-miR171a-5p

Accession MIMAT0015154
Previous IDszma-miR171a*

3 - 


 - 23

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR171a-3p

Accession MIMAT0001385
Previous IDszma-miR171a

79 - 


 - 98

Get sequence
Deep sequencing2191 reads, 129 experiments
Evidence experimental; Illumina [2]


"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).