Stem-loop sequence zma-MIR166d

AccessionMI0001490 (change log)
DescriptionZea mays miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166d
(187 sentences)

Stem-loop
   gu      uu         a      uu   uuugu      ---ucugug   a 
5'   ggaaug  gucugguuc aggucu  ugc     gaucca         uag g
     ||||||  ||||||||| ||||||  |||     ||||||         ||| c
3'   ccuuac  cggaccagg ucuaga  acg     cuaggu         auc u
   cc      uu         c      --   ----u      uccuuauga   u 
Get sequence
Deep sequencing
155058 reads, 2.37e+04 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 22443534-22443637 [-]
intergenic
Database links

Mature sequence zma-miR166d-5p

Accession MIMAT0015153
Previous IDszma-miR166d*
Sequence

3 - 

ggaauguugucugguucaagg

 - 23

Get sequence
Deep sequencing292 reads, 17 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR166d-3p

Accession MIMAT0001384
Previous IDszma-miR166d
Sequence

84 - 

ucggaccaggcuucauuccc

 - 103

Get sequence
Deep sequencing154746 reads, 60 experiments
Evidence experimental; Illumina [3]

References

1
PMID:14999285 "microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity" Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC Nature. 428:84-88(2004).
2
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).