Stem-loop sequence zma-MIR166c

AccessionMI0001489 (change log)
DescriptionZea mays miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166c
(190 sentences)

Stem-loop
           uu      cu      --    a   -acgca        
5' ggggaaug  gucugg  cgaggu  gcag aac      gaucuca 
   ||||||||  ||||||  ||||||  |||| |||      |||||| u
3' ccccuuac  cggacc  gcucua  uguu uug      cuggagc 
           uu      ag      gu    g   guucug        
Get sequence
Deep sequencing
155431 reads, 2.42e+04 reads per million, 60 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 153858453-153858544 [+]
intergenic
Database links

Mature sequence zma-miR166c-5p

Accession MIMAT0015152
Previous IDszma-miR166c*
Sequence

3 - 

ggaauguugucuggcucgagg

 - 23

Get sequence
Deep sequencing651 reads, 9 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR166c-3p

Accession MIMAT0001383
Previous IDszma-miR166c
Sequence

72 - 

ucggaccaggcuucauuccc

 - 91

Get sequence
Deep sequencing154752 reads, 57 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:14999285 "microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity" Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC Nature. 428:84-88(2004).
2
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).