Stem-loop sequence zma-MIR166b

AccessionMI0001488 (change log)
DescriptionZea mays miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

33 open access papers mention zma-MIR166b
(196 sentences)

Stem-loop
   gu      uu         a        cuwucc          ----------ug uc    c 
5'   ggaaug  gucugguuc aggucuug      gauuugagga            a  caug u
     ||||||  ||||||||| ||||||||      ||||||||||            |  ||||  
3'   ccuuac  cggaccagg ucuagaac      cuagacuccu            u  guac u
   cc      uu         c        ----au          uguuuuuuuuga gu    g 
Get sequence
Deep sequencing
155053 reads, 2.45e+04 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 226759256-226759371 [-]
intergenic
chr9: 90025277-90025392 [+]
intergenic
LPUQ01000072.1: 2455-2570 [+]
intergenic
Database links

Mature sequence zma-miR166b-5p

Accession MIMAT0015151
Previous IDszma-miR166b*
Sequence

3 - 

ggaauguugucugguucaagg

 - 23

Get sequence
Deep sequencing292 reads, 17 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR166b-3p

Accession MIMAT0001382
Previous IDszma-miR166b
Sequence

96 - 

ucggaccaggcuucauuccc

 - 115

Get sequence
Deep sequencing154746 reads, 60 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:14999285 "microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity" Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC Nature. 428:84-88(2004).
2
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).