Stem-loop sequence zma-MIR166g

AccessionMI0001487 (change log)
DescriptionZea mays miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

33 open access papers mention zma-MIR166g
(190 sentences)

Stem-loop
           uu        g       aa    rcgaauua     c    cc     a    - aua 
5' ggggaaug  gucugguu gagaccu  cacc        aucau caug  augga gcag c   u
   ||||||||  |||||||| |||||||  ||||        ||||| ||||  ||||| |||| |    
3' ccccuuac  cggaccag cuuugga  gugg        uagua guac  uaucu cguc g   g
           uu        g       ag    --------     c    -c     a    c ccc 
Get sequence
Deep sequencing
156028 reads, 9.91e+03 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 13782628-13782753 [+]
intergenic
Database links

Mature sequence zma-miR166g-5p

Accession MIMAT0015150
Previous IDszma-miR166g*
Sequence

3 - 

ggaauguugucugguuggaga

 - 23

Get sequence
Deep sequencing361 reads, 120 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR166g-3p

Accession MIMAT0001381
Previous IDszma-miR166g
Sequence

106 - 

ucggaccaggcuucauuccc

 - 125

Get sequence
Deep sequencing155603 reads, 148 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).