Stem-loop sequence zma-MIR166f

AccessionMI0001486 (change log)
DescriptionZea mays miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166f
(189 sentences)

Stem-loop
            c   c       aca    a    u cu    
5' ggggaauga guc gguccga   agcc cggc g  gcu 
   ||||||||| ||| |||||||   |||| |||| |  || g
3' ccccuuacu cgg ccaggcu   ucgg gccg c  cgc 
            u   a       ---    c    c au    
Get sequence
Deep sequencing
155283 reads, 9.43e+03 reads per million, 168 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 8289186-8289263 [+]
intergenic
Database links

Mature sequence zma-miR166f

Accession MIMAT0001380
Sequence

58 - 

ucggaccaggcuucauuccc

 - 77

Get sequence
Deep sequencing154357 reads, 144 experiments
Evidence by similarity; MI0000201
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).