Stem-loop sequence zma-MIR166i

AccessionMI0001485 (change log)
DescriptionZea mays miR166i stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166i
(188 sentences)

Stem-loop
           uc      - g         a  a      gugc 
5' ggggaaug  gucugg c cgagaccgu cc gacgac    u
   ||||||||  |||||| | ||||||||| || ||||||    c
3' ccccuuac  cggacc g gcucuggca gg cugcug    u
           uu      a -         -  -      gcuc 
Get sequence
Deep sequencing
156489 reads, 9.46e+03 reads per million, 179 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 244940015-244940097 [+]
intergenic
Database links

Mature sequence zma-miR166i-5p

Accession MIMAT0015149
Previous IDszma-miR166i*
Sequence

3 - 

ggaaugucgucuggcgcgaga

 - 23

Get sequence
Deep sequencing221 reads, 112 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR166i-3p

Accession MIMAT0001379
Previous IDszma-miR166i
Sequence

63 - 

ucggaccaggcuucauuccc

 - 82

Get sequence
Deep sequencing154878 reads, 156 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).