Stem-loop sequence zma-MIR166e

AccessionMI0001483 (change log)
DescriptionZea mays miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166e
(189 sentences)

Stem-loop
           uu      cu      --   ga   auac     u 
5' ggggaaug  gucugg  cgaggu  gca  aac    agauc c
   ||||||||  ||||||  ||||||  |||  |||    ||||| a
3' ccccuuac  cggacc  gcucua  ugu  uug    ucugg u
           uu      ag      gc   uc   --ga     c 
Get sequence
Deep sequencing
155601 reads, 8.91e+03 reads per million, 165 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 195602244-195602330 [+]
intergenic
Database links

Mature sequence zma-miR166e

Accession MIMAT0001378
Sequence

67 - 

ucggaccaggcuucauuccc

 - 86

Get sequence
Deep sequencing154729 reads, 57 experiments
Evidence by similarity; MI0000207
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).