Stem-loop sequence zma-MIR166h

AccessionMI0001482 (change log)
DescriptionZea mays miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166h
(189 sentences)

Stem-loop
            c   c       acg    -a    u  ug 
5' ggggaauga guc gguccga   agcc  cggc gc  c
   ||||||||| ||| |||||||   ||||  |||| ||   
3' ccccuuacu cgg ccaggcu   ucgg  gccg cg  u
            u   a       ---    gc    c  cg 
Get sequence
Deep sequencing
165838 reads, 1.56e+04 reads per million, 214 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 279585912-279585987 [-]
intergenic
Database links

Mature sequence zma-miR166h-5p

Accession MIMAT0015148
Previous IDszma-miR166h*
Sequence

3 - 

ggaaugacguccgguccgaac

 - 23

Get sequence
Deep sequencing247 reads, 122 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR166h-3p

Accession MIMAT0001377
Previous IDszma-miR166h
Sequence

56 - 

ucggaccaggcuucauuccc

 - 75

Get sequence
Deep sequencing154346 reads, 144 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).