Stem-loop sequence zma-MIR162

AccessionMI0001481 (change log)
DescriptionZea mays miR162 stem-loop
Gene family MIPF0000169; MIR162_2
Literature search

20 open access papers mention zma-MIR162
(53 sentences)

Stem-loop
       gc    u            uc     u  c    gcugguccggccgggaguggugguuc 
5' cugg  gcag gguuuaucgauc  uuccu gc uugu                          a
   ||||  |||| ||||||||||||  ||||| || ||||                          a
3' gacc  cguc ccaaauagcugg  aaggg cg aaca                          g
       ua    u            cu     -  c    aacgcucgacgacguuguuauuuugc 
Get sequence
Deep sequencing
3896 reads, 2.96e+03 reads per million, 186 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 186614119-186614248 [+]
intergenic
Database links

Mature sequence zma-miR162-5p

Accession MIMAT0015147
Previous IDszma-miR162*
Sequence

3 - 

gggcgcagugguuuaucgauc

 - 23

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR162-3p

Accession MIMAT0001376
Previous IDszma-miR162
Sequence

110 - 

ucgauaaaccucugcaucca

 - 129

Get sequence
Deep sequencing409 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).