Stem-loop sequence zma-MIR166a

AccessionMI0001480 (change log)
DescriptionZea mays miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

34 open access papers mention zma-MIR166a
(202 sentences)

Stem-loop
   -  a        uu      cu    gc gc      -  -    u   uu   uagucucucuucucuccuagcagcuacucuucgcuuccuacuccuaucucgau 
5'  ug ggggaaug  gucugg  cggg  c  cgccgc cg cucc ucc  cuc                                                     c
    || ||||||||  ||||||  ||||  |  |||||| || |||| |||  |||                                                     c
3'  ac ccccuuac  cggacc  gcuc  g  guggug gc gagg agg  gag                                                     c
   a  c        uu      ag    ua au      a  a    c   -c   ccagagcuagguucucuccccccuucuccuucuucuucuucuucuucuucucu 
Get sequence
Deep sequencing
158827 reads, 1.06e+04 reads per million, 213 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 87381728-87381940 [+]
intergenic
Database links

Mature sequence zma-miR166a-5p

Accession MIMAT0015146
Previous IDszma-miR166a*
Sequence

6 - 

ggaauguugucuggcucgggg

 - 26

Get sequence
Deep sequencing1293 reads, 171 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR166a-3p

Accession MIMAT0001375
Previous IDszma-miR166a
Sequence

189 - 

ucggaccaggcuucauucccc

 - 209

Get sequence
Deep sequencing155461 reads, 207 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:14999285 "microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity" Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC Nature. 428:84-88(2004).
2
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).