Stem-loop sequence zma-MIR160e

AccessionMI0001479 (change log)
DescriptionZea mays miR160e stem-loop
Gene family MIPF0000032; MIR160
Literature search

21 open access papers mention zma-MIR160e
(73 sentences)

Stem-loop
   a   aa     c    u  c         cu    -        ac 
5'  ggg  uaugc uggc cc uguaugcca  cgca cggcuacc  a
    |||  ||||| |||| || |||||||||  |||| ||||||||  c
3'  ccc  guacg accg gg gcgugcggu  gcgu gccggugg  c
   c   cg     a    u  a         cg    c        cc 
Get sequence
Deep sequencing
1099 reads, 544 reads per million, 145 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence zma-miR160e

Accession MIMAT0001374
Sequence

9 - 

ugccuggcucccuguaugcca

 - 29

Get sequence
Deep sequencing638 reads, 9 experiments
Evidence by similarity; MI0000190

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).