Stem-loop sequence zma-MIR167c

AccessionMI0001478 (change log)
DescriptionZea mays miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

29 open access papers mention zma-MIR167c
(126 sentences)

Stem-loop
   u      ----     c      a       --            uc  a        -g    gaga 
5'  gcccaa    gggaa gaguga gcugcca  gcaugaucuagc  gg gugaucac  cgag    a
    ||||||    ||||| |||||| |||||||  ||||||||||||  || ||||||||  ||||    c
3'  cggguu    cccuu uucacu cgacggu  cguacuagaucg  cc uacuggug  gcuc    a
   a      ccug     c      c       gu            uu  g        ga    gaua 
Get sequence
Deep sequencing
26695 reads, 3.3e+03 reads per million, 174 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 4414244-4414375 [+]
intergenic
Database links

Mature sequence zma-miR167c-5p

Accession MIMAT0001373
Previous IDszma-miR167c
Sequence

17 - 

ugaagcugccagcaugaucua

 - 37

Get sequence
Deep sequencing24804 reads, 164 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR167c-3p

Accession MIMAT0015145
Previous IDszma-miR167c*
Sequence

92 - 

gaucaugcuguggcagccucacu

 - 114

Get sequence
Deep sequencing276 reads, 109 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).