Stem-loop sequence zma-MIR167d

AccessionMI0001477 (change log)
DescriptionZea mays miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

29 open access papers mention zma-MIR167d
(127 sentences)

Stem-loop
   u      ----     c      a     --              ucuga         cgaaaa     a 
5'  gcccaa    gggaa gaguga gcugc  cagcaugaucuagc     gugaucacc      agaac a
    ||||||    ||||| |||||| |||||  ||||||||||||||     |||||||||      |||||  
3'  cggguu    cccuu uucacu cgacg  gucguacuggaucg     uacuggugg      ucuug u
   a      gcug     c      c     uc              uuccg         -----a     a 
Get sequence
Deep sequencing
25479 reads, 2.36e+03 reads per million, 174 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 292918639-292918771 [-]
intergenic
Database links

Mature sequence zma-miR167d-5p

Accession MIMAT0001372
Previous IDszma-miR167d
Sequence

17 - 

ugaagcugccagcaugaucua

 - 37

Get sequence
Deep sequencing24807 reads, 165 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR167d-3p

Accession MIMAT0015144
Previous IDszma-miR167d*
Sequence

93 - 

ggucaugcugcugcagccucacu

 - 115

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).