Stem-loop sequence zma-MIR167b

AccessionMI0001476 (change log)
DescriptionZea mays miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

29 open access papers mention zma-MIR167b
(132 sentences)

Stem-loop
   a         -au              - -              gacgg   ug   u  -u   gc 
5'  gugcccaag   aaagggugaagcug c cagcaugaucuaac     cau  cuc gc  gcu  a
    |||||||||   |||||||||||||| | ||||||||||||||     |||  ||| ||  |||  g
3'  cacggguuu   uuucucacuuugac g gucguacuagauug     gua  gag cg  cgg  u
   a         ccc              a u              -----   gu   -  uu   ag 
Get sequence
Deep sequencing
25537 reads, 2.44e+03 reads per million, 196 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 7976369-7976495 [+]
intergenic
Database links

Mature sequence zma-miR167b-5p

Accession MIMAT0001371
Previous IDszma-miR167b
Sequence

19 - 

ugaagcugccagcaugaucua

 - 39

Get sequence
Deep sequencing25322 reads, 193 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR167b-3p

Accession MIMAT0015143
Previous IDszma-miR167b*
Sequence

88 - 

gaucaugcugugacaguuucacu

 - 110

Get sequence
Deep sequencing69 reads, 18 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).