Stem-loop sequence zma-MIR167a

AccessionMI0001475 (change log)
DescriptionZea mays miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

31 open access papers mention zma-MIR167a
(141 sentences)

Stem-loop
   u     -----  c   u      a    c  -            uc       guu     cauauuagc     uccac      -      u      -    
5'  gcucu     ug gaa gaguga gcug ca gcaugaucuagc  ugauuug   ggcac         aggcg     gcacag cuagac agagug gcc 
    |||||     || ||| |||||| |||| || ||||||||||||  |||||||   |||||         |||||     |||||| |||||| |||||| || u
3'  cgggg     ac cuu cuuacu cgac gu cguacuagauug  gcuaaac   ccgug         uucgc     uguguc ggucug ucucgc cgc 
   -     ucuua  a   c      c    a  a            uu       -gu     --------u     ---uc      u      c      g    
Get sequence
Deep sequencing
25575 reads, 2.43e+03 reads per million, 171 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 119392621-119392810 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR167a
zma-MIR167achr3: 119392621-119392810 [+]
zma-MIR167gchr3: 119394584-119394826 [+]
Database links

Mature sequence zma-miR167a-5p

Accession MIMAT0001370
Previous IDszma-miR167a
Sequence

17 - 

ugaagcugccagcaugaucua

 - 37

Get sequence
Deep sequencing24758 reads, 158 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR167a-3p

Accession MIMAT0015142
Previous IDszma-miR167a*
Sequence

151 - 

gaucaugcaugacagccucauu

 - 172

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).