Stem-loop sequence zma-MIR169b

AccessionMI0001474 (change log)
DescriptionZea mays miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

30 open access papers mention zma-MIR169b
(217 sentences)

Stem-loop
       cu    ga        c         ug          cuaucgucgaucaacgagcgacgccucugaugucu 
5' uagg  cggg  cuacggug agccaagga  acuugccgau                                   g
   ||||  ||||  |||||||| |||||||||  ||||||||||                                    
3' gucc  gucc  ggugccac ucgguucuu  ugaacggcua                                   a
       uc    uc        a         gu          ucuacuacuaccagacugcugcuaucuacagcucu 
Get sequence
Deep sequencing
2850 reads, 1.62e+03 reads per million, 176 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 5012331-5012486 [-]
intergenic
Database links

Mature sequence zma-miR169b-5p

Accession MIMAT0001369
Previous IDszma-miR169b
Sequence

21 - 

cagccaaggaugacuugccga

 - 41

Get sequence
Deep sequencing1133 reads, 23 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR169b-3p

Accession MIMAT0015141
Previous IDszma-miR169b*
Sequence

118 - 

ggcaaguuguucuuggcuaca

 - 138

Get sequence
Deep sequencing77 reads, 10 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).