Stem-loop sequence zma-MIR169a

AccessionMI0001473 (change log)
DescriptionZea mays miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

30 open access papers mention zma-MIR169a
(217 sentences)

Stem-loop
       cu    ga        c         ug         ucgaugugacgccucuugaucuc 
5' uagg  cggg  cuauggug agccaagga  acuugccga                       g
   ||||  ||||  |||||||| |||||||||  |||||||||                        
3' gucc  gucc  ggugccac ucgguucuu  ugaacggcu                       u
       uc    uc        a         gu         acuagccgcugcuagacugcugc 
Get sequence
Deep sequencing
2723 reads, 1.58e+03 reads per million, 173 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 37346686-37346815 [+]
intergenic
Database links

Mature sequence zma-miR169a-5p

Accession MIMAT0001368
Previous IDszma-miR169a
Sequence

21 - 

cagccaaggaugacuugccga

 - 41

Get sequence
Deep sequencing1140 reads, 25 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR169a-3p

Accession MIMAT0015140
Previous IDszma-miR169a*
Sequence

92 - 

ggcaaguuguucuuggcuaca

 - 112

Get sequence
Deep sequencing80 reads, 10 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).