Stem-loop sequence zma-MIR164c

AccessionMI0001472 (change log)
DescriptionZea mays miR164c stem-loop
Gene family MIPF0000045; MIR164
Literature search

29 open access papers mention zma-MIR164c
(203 sentences)

Stem-loop
   u         c  g           c             u uu  c    -          u   agcggccggcggcccggcucucgcagucacgcguacgucgccugagcggcgcgcgcgagagagagagaca 
5'  ggcgaggug gc cgguggagaag agggcacgugcau c  uc gucg ccggccggcu ggc                                                                      c
    ||||||||| || ||||||||||| ||||||||||||| |  || |||| |||||||||| |||                                                                      g
3'  ccgcuccgc cg gcuaccucuuc ucccguguacgug g  ag uagc ggccggccgg ccg                                                                      g
   u         a  g           u             c -u  c    c          -   accgaccgaccgacccaaagucuucgaucgacgacguggacguggucaaucggcgcggccgcugcuggac 
Get sequence
Deep sequencing
38141 reads, 2.65e+04 reads per million, 217 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 157477837-157478106 [+]
intergenic
Database links

Mature sequence zma-miR164c-5p

Accession MIMAT0001367
Previous IDszma-miR164c
Sequence

18 - 

uggagaagcagggcacgugca

 - 38

Get sequence
Deep sequencing4192 reads, 174 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR164c-3p

Accession MIMAT0015139
Previous IDszma-miR164c*
Sequence

235 - 

caugugcccuucuucuccauc

 - 255

Get sequence
Deep sequencing314 reads, 105 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).