Stem-loop sequence zma-MIR164b

AccessionMI0001471 (change log)
DescriptionZea mays miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

29 open access papers mention zma-MIR164b
(215 sentences)

Stem-loop
   u       ggc     g           ca        g  -uu        ---aug     g g 
5'  agacggu   ugugc ugguggagaag  gggcacgu ca   accaucca      ccgcc g u
    |||||||   ||||| |||||||||||  |||||||| ||   ||||||||      ||||| | g
3'  ucuguca   gcacg gccaccucuuc  cccgugua gu   ugguaggu      ggugg u g
   u       --a     a           ua        -  ucu        agguaa     g g 
Get sequence
Deep sequencing
6414 reads, 2.47e+03 reads per million, 202 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 145727415-145727542 [+]
intergenic
Database links

Mature sequence zma-miR164b-5p

Accession MIMAT0001366
Previous IDszma-miR164b
Sequence

21 - 

uggagaagcagggcacgugca

 - 41

Get sequence
Deep sequencing4373 reads, 184 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR164b-3p

Accession MIMAT0015138
Previous IDszma-miR164b*
Sequence

93 - 

augugcccaucuucuccacc

 - 112

Get sequence
Deep sequencing315 reads, 105 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).