Stem-loop sequence zma-MIR164d

AccessionMI0001470 (change log)
DescriptionZea mays miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

28 open access papers mention zma-MIR164d
(201 sentences)

Stem-loop
   u            -  acgc        c   g       a     auacgccauucucgaucucuccucuccaccacuacugcaucuagcuaucuccauggaugga 
5'  gagugagaagga cc    uggagaag agg cacgugc ugcac                                                             u
    |||||||||||| ||    |||||||| ||| ||||||| |||||                                                             g
3'  uucacucuuucu gg    accucuuc ucu gugcacg acgug                                                             u
   c            u  cacu        c   g       c     ucggucguacguacucgagcgaucgaauaacgaagaggcuagcuaggucaggcucgaugca 
Get sequence
Deep sequencing
4395 reads, 857 reads per million, 168 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 178154786-178155001 [+]
intergenic
Database links

Mature sequence zma-miR164d-5p

Accession MIMAT0001365
Previous IDszma-miR164d
Sequence

20 - 

uggagaagcagggcacgugca

 - 40

Get sequence
Deep sequencing3941 reads, 39 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR164d-3p

Accession MIMAT0015137
Previous IDszma-miR164d*
Sequence

178 - 

cacguggucuccuucuccau

 - 197

Get sequence
Deep sequencing111 reads, 108 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).