Stem-loop sequence zma-MIR164a

AccessionMI0001469 (change log)
DescriptionZea mays miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

31 open access papers mention zma-MIR164a
(226 sentences)

Stem-loop
   c     c       a  c        c           a    cauaccauauagcuagacgauguucucucucg 
5'  aguga aaggacc cg uggagaag agggcacgugc ugcg                                c
    ||||| ||||||| || |||||||| ||||||||||| ||||                                 
3'  ucacu uuucugg gc accucuuc ucuugugcacg acgc                                u
   u     c       a  u        c           c    auggguagguauguacuucgaaccagcucgcc 
Get sequence
Deep sequencing
4177 reads, 634 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 223401157-223401308 [-]
intergenic
Database links

Mature sequence zma-miR164a-5p

Accession MIMAT0001364
Previous IDszma-miR164a
Sequence

19 - 

uggagaagcagggcacgugca

 - 39

Get sequence
Deep sequencing3923 reads, 36 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR164a-3p

Accession MIMAT0015136
Previous IDszma-miR164a*
Sequence

116 - 

cacguguucuccuucuccauc

 - 136

Get sequence
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).