Stem-loop sequence zma-MIR160b

AccessionMI0001468 (change log)
DescriptionZea mays miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

21 open access papers mention zma-MIR160b
(73 sentences)

Stem-loop
   c    --    cg   cg       c       c        acacauguagcca     ug    ga 
5'  gauc  ggcu  ugu  ugugugc uggcucc uguaugcc             acccg  gcgu  u
    ||||  ||||  |||  ||||||| ||||||| ||||||||             |||||  ||||   
3'  cuag  ccgg  aca  acguacg accgagg acgugcgg             ugggu  cgua  u
   a    ua    --   au       a       a        -------------     gu    gg 
Get sequence
Deep sequencing
2236 reads, 1.45e+03 reads per million, 155 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 44296768-44296888 [-]
intergenic
Database links

Mature sequence zma-miR160b-5p

Accession MIMAT0001363
Previous IDszma-miR160b
Sequence

21 - 

ugccuggcucccuguaugcca

 - 41

Get sequence
Deep sequencing640 reads, 11 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR160b-3p

Accession MIMAT0015135
Previous IDszma-miR160b*
Sequence

83 - 

gcgugcaaggagccaagcaug

 - 103

Get sequence
Deep sequencing94 reads, 5 experiments
Evidence experimental; Illumina [3]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).