Stem-loop sequence zma-MIR160d

AccessionMI0001467 (change log)
DescriptionZea mays miR160d stem-loop
Gene family MIPF0000032; MIR160
Literature search

21 open access papers mention zma-MIR160d
(72 sentences)

Stem-loop
   -  cc     cgg     -a     c       c         cu    -   cu      --ucaucau   u 
5'  gg  agggg   gaucg  uaugc uggcucc uguaugcca  cgca ugg  gccaac         gca a
    ||  |||||   |||||  ||||| ||||||| |||||||||  |||| |||  ||||||         ||| c
3'  cc  uccuc   cuagc  guacg accgagg gcgugcggu  gcgu acc  cgguug         cgu a
   u  --     -ua     ca     a       u         ag    c   -u      cugaucgau   c 
Get sequence
Deep sequencing
2619 reads, 1.7e+03 reads per million, 173 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 288700634-288700775 [-]
intergenic
Database links

Mature sequence zma-miR160d-5p

Accession MIMAT0001362
Previous IDszma-miR160d
Sequence

21 - 

ugccuggcucccuguaugcca

 - 41

Get sequence
Deep sequencing648 reads, 13 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR160d-3p

Accession MIMAT0015134
Previous IDszma-miR160d*
Sequence

105 - 

gcgugcguggagccaagcaug

 - 125

Get sequence
Deep sequencing17 reads, 10 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).