Stem-loop sequence zma-MIR160c

AccessionMI0001466 (change log)
DescriptionZea mays miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

21 open access papers mention zma-MIR160c
(72 sentences)

Stem-loop
   a        c    u  c         cu     agagcaacgacagcu 
5'  ggaugugc uggc cc uguaugcca  caucu               u
    |||||||| |||| || |||||||||  |||||                
3'  ucuauacg accg gg acgugcggu  guaga               g
   c        a    u  u         ag     auauccguugggaug 
Get sequence
Deep sequencing
1121 reads, 596 reads per million, 138 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 9551862-9551961 [+]
intergenic
Database links

Mature sequence zma-miR160c-5p

Accession MIMAT0001361
Previous IDszma-miR160c
Sequence

7 - 

ugccuggcucccuguaugcca

 - 27

Get sequence
Deep sequencing635 reads, 11 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR160c-3p

Accession MIMAT0015133
Previous IDszma-miR160c*
Sequence

76 - 

gcgugcauggugccaagcaua

 - 96

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).