Stem-loop sequence zma-MIR160a

AccessionMI0001465 (change log)
DescriptionZea mays miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

22 open access papers mention zma-MIR160a
(80 sentences)

Stem-loop
   u  ug       c       c          a   gu    cc     caga 
5'  ug  ugcgugc uggcucc uguaugccac cau  agcg  caacc    u
    ||  ||||||| ||||||| |||||||||| |||  ||||  |||||     
3'  ac  acguacg accgggg acgugcggug gug  ucgu  guugg    g
   u  cu       a       a          g   --    cc     aauy 
Get sequence
Deep sequencing
2327 reads, 1.54e+03 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 241638522-241638625 [+]
intergenic
Database links

Mature sequence zma-miR160a-5p

Accession MIMAT0001360
Previous IDszma-miR160a
Sequence

10 - 

ugccuggcucccuguaugcca

 - 30

Get sequence
Deep sequencing637 reads, 10 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR160a-3p

Accession MIMAT0015132
Previous IDszma-miR160a*
Sequence

77 - 

gcgugcaaggggccaagcaug

 - 97

Get sequence
Deep sequencing201 reads, 112 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).