Stem-loop sequence zma-MIR156i

AccessionMI0001464 (change log)
DescriptionZea mays miR156i stem-loop
Gene family MIPF0000008; MIR156
Literature search

52 open access papers mention zma-MIR156i
(340 sentences)

Stem-loop
   c    c   -------c         -    -         a  g   g cgga         g 
5'  gcgg ggg        ggugacaga agag agugagcac cg ccg g    acggcaccg c
    |||| |||        ||||||||| |||| ||||||||| || ||| |    ||||||||| g
3'  cgcc ccc        cuacugucu ucuc ucacucgug gc ggc c    ugccguggu g
   u    -   ucucucac         a    g         c  a   g ----         a 
Get sequence
Deep sequencing
256594 reads, 4.48e+04 reads per million, 218 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 140280587-140280703 [-]
intergenic
Database links

Mature sequence zma-miR156i-5p

Accession MIMAT0001359
Previous IDszma-miR156i
Sequence

13 - 

ugacagaagagagugagcac

 - 32

Get sequence
Deep sequencing222006 reads, 218 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR156i-3p

Accession MIMAT0015131
Previous IDszma-miR156i*
Sequence

80 - 

gcucacugcucuaucugucauc

 - 101

Get sequence
Deep sequencing135 reads, 15 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).