Stem-loop sequence zma-MIR156h

AccessionMI0001463 (change log)
DescriptionZea mays miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

51 open access papers mention zma-MIR156h
(339 sentences)

Stem-loop
   c       c  g  c    -        -   -         a     gggc        a 
5'  gggcucg gc cg gcgg ugacagaa gag agugagcac cggcc    gugacggc c
    ||||||| || || |||| |||||||| ||| ||||||||| |||||    ||||||||  
3'  uccgggc ug gu cgcc acugucuu cuc ucacucgug gccgg    cgcugccg g
   c       c  -  -    u        u   g         c     ----        u 
Get sequence
Deep sequencing
226992 reads, 2.32e+04 reads per million, 218 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 129642870-129642984 [-]
intergenic
Database links

Mature sequence zma-miR156h-5p

Accession MIMAT0001358
Previous IDszma-miR156h
Sequence

20 - 

ugacagaagagagugagcac

 - 39

Get sequence
Deep sequencing222014 reads, 218 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR156h-3p

Accession MIMAT0015130
Previous IDszma-miR156h*
Sequence

78 - 

gcucacugcucuuucugucauc

 - 99

Get sequence
Deep sequencing202 reads, 10 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).