Stem-loop sequence zma-MIR156e

AccessionMI0001461 (change log)
DescriptionZea mays miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

51 open access papers mention zma-MIR156e
(341 sentences)

Stem-loop
   c  - c   c c  gc    -       -    -         a     ggu          cggc 
5'  cg g ggg g gc  gcgg ugacaga agag agugagcac cggcc   gugacggcac    g
    || | ||| | ||  |||| ||||||| |||| ||||||||| |||||   ||||||||||     
3'  gc c ccc c cg  cgcc acugucu ucuc ucacucgug gccgg   cgcugccgug    c
   -  a u   a a  gu    u       c    g         c     ---          uagg 
Get sequence
Deep sequencing
224644 reads, 2.17e+04 reads per million, 218 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 33005026-33005151 [+]
intergenic
Database links

Mature sequence zma-miR156e-5p

Accession MIMAT0001356
Previous IDszma-miR156e
Sequence

20 - 

ugacagaagagagugagcac

 - 39

Get sequence
Deep sequencing222014 reads, 218 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR156e-3p

Accession MIMAT0015128
Previous IDszma-miR156e*
Sequence

87 - 

gcucacugcucucucugucauc

 - 108

Get sequence
Deep sequencing545 reads, 131 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).