Stem-loop sequence zma-MIR156e

AccessionMI0001461
DescriptionZea mays miR156e stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c  - c   c c  gc    -       -    -         a     ggu          cggc 
5'  cg g ggg g gc  gcgg ugacaga agag agugagcac cggcc   gugacggcac    g
    || | ||| | ||  |||| ||||||| |||| ||||||||| |||||   ||||||||||     
3'  gc c ccc c cg  cgcc acugucu ucuc ucacucgug gccgg   cgcugccgug    c
   -  a u   a a  gu    u       c    g         c     ---          uagg 
Get sequence
Deep sequencing
120143 reads, 1.25e+05 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (RefGen_v2) Overlapping transcripts
chr2: 31493020-31493145 [+]
intergenic
Database links

Mature sequence zma-miR156e-5p

Accession MIMAT0001356
Previous IDszma-miR156e
Sequence

20 - 

ugacagaagagagugagcac

 - 39

Get sequence
Deep sequencing119974 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR156e-3p

Accession MIMAT0015128
Previous IDszma-miR156e*
Sequence

87 - 

gcucacugcucucucugucauc

 - 108

Get sequence
Deep sequencing15 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).