Stem-loop sequence zma-MIR156c

AccessionMI0001460 (change log)
DescriptionZea mays miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

51 open access papers mention zma-MIR156c
(339 sentences)

Stem-loop
             agg   aa         -     -        a      gccu   uu      uguauga  g 
5' gguggaggag   uga  gcugacaga agaga gugagcac cauggu    uuc  gcauga       uc a
   ||||||||||   |||  ||||||||| ||||| |||||||| ||||||    |||  ||||||       ||  
3' cuaucuccuc   auu  cgacuguuu ucucu cacucgug guaucg    aag  cguacu       ag g
             aag   ac         c     u        c      ----   cu      -----ug  a 
Get sequence
Deep sequencing
209884 reads, 8.37e+03 reads per million, 207 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence zma-miR156c

Accession MIMAT0001355
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Deep sequencing209695 reads, 207 experiments
Evidence experimental; Illumina [3]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).