Stem-loop sequence zma-MIR156c

AccessionMI0001460
DescriptionZea mays miR156c stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
             agg   aa         -     -        a      gccu   uu      uguauga  g 
5' gguggaggag   uga  gcugacaga agaga gugagcac cauggu    uuc  gcauga       uc a
   ||||||||||   |||  ||||||||| ||||| |||||||| ||||||    |||  ||||||       ||  
3' cuaucuccuc   auu  cgacuguuu ucucu cacucgug guaucg    aag  cguacu       ag g
             aag   ac         c     u        c      ----   cu      -----ug  a 
Get sequence
Deep sequencing
1341 reads, 1.39e+03 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence zma-miR156c

Accession MIMAT0001355
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Evidence experimental; Illumina [3]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).