Stem-loop sequence zma-MIR156b

AccessionMI0001459 (change log)
DescriptionZea mays miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

52 open access papers mention zma-MIR156b
(344 sentences)

Stem-loop
        a    uu   ag u        -    a        a      gguu     c    a 
5' agaug guuu  uga  g uugacaga agag gugagcac cacggu    ucuua caug g
   ||||| ||||  |||  | |||||||| |||| |||||||| ||||||    ||||| |||| u
3' ucuac cgaa  acu  c gacugucu ucuc cacucgug gugucg    aggau guac g
        c    cu   ca u        a    c        c      ----     c    u 
Get sequence
Deep sequencing
222712 reads, 1.69e+04 reads per million, 217 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 6928278-6928401 [-]
intergenic
Database links

Mature sequence zma-miR156b-5p

Accession MIMAT0001354
Previous IDszma-miR156b
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Deep sequencing222547 reads, 217 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR156b-3p

Accession MIMAT0015127
Previous IDszma-miR156b*
Sequence

86 - 

gcucacccucuaucugucagu

 - 106

Get sequence
Deep sequencing100 reads, 33 experiments
Evidence experimental; Illumina [3]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).