Stem-loop sequence zma-MIR156g

AccessionMI0001458 (change log)
DescriptionZea mays miR156g stem-loop
Gene family MIPF0000008; MIR156
Literature search

51 open access papers mention zma-MIR156g
(361 sentences)

Stem-loop
              -    -           u    cagacugcaucuauauacggcugcucc 
5' ggcugacagaa gaga gugagcacgca cggc                           u
   ||||||||||| |||| ||||||||||| ||||                           g
3' ucgacugucuu cucu cacucgugcgu gucg                           g
              u    u           u    ucgacgcggaaccguagauagguaagc 
Get sequence
Deep sequencing
206423 reads, 5.55e+03 reads per million, 185 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 119411284-119411404 [+]
intergenic
Database links

Mature sequence zma-miR156g-5p

Accession MIMAT0001353
Previous IDszma-miR156g
Sequence

4 - 

ugacagaagagagugagcac

 - 23

Get sequence
Deep sequencing204309 reads, 161 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR156g-3p

Accession MIMAT0015126
Previous IDszma-miR156g*
Sequence

99 - 

gcucacuucucuuucugucagc

 - 120

Get sequence
Deep sequencing529 reads, 38 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).