Stem-loop sequence zma-MIR156f

AccessionMI0001457 (change log)
DescriptionZea mays miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

51 open access papers mention zma-MIR156f
(338 sentences)

Stem-loop
   u  c  cu   u  u u           -    -           u    c  a    aucuauauacggcugccccaaagcgacg 
5'  gg ug  aga gg g ggcugacagaa gaga gugagcacgca cggc ag cugc                            g
    || ||  ||| || | ||||||||||| |||| ||||||||||| |||| || ||||                             
3'  cc ac  ucu uc c ucgacugucuu cucu cacucgugcgu gucg uc gacg                            a
   u  u  --   c  u -           u    u           u    -  -    cggauccggauccgauccguagguagcu 
Get sequence
Deep sequencing
209045 reads, 7.57e+03 reads per million, 215 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 185613978-185614144 [-]
intergenic
Database links

Mature sequence zma-miR156f-5p

Accession MIMAT0001352
Previous IDszma-miR156f
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Deep sequencing207370 reads, 210 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR156f-3p

Accession MIMAT0015125
Previous IDszma-miR156f*
Sequence

131 - 

gcucacuucucuuucugucagc

 - 152

Get sequence
Deep sequencing810 reads, 167 experiments
Evidence experimental; Illumina [2]

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).