Stem-loop sequence zma-MIR156f

AccessionMI0001457 (change log)
DescriptionZea mays miR156f stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   u  c  cu   u  u u           -    -           u    c  a    aucuauauacggcugccccaaagcgacg 
5'  gg ug  aga gg g ggcugacagaa gaga gugagcacgca cggc ag cugc                            g
    || ||  ||| || | ||||||||||| |||| ||||||||||| |||| || ||||                             
3'  cc ac  ucu uc c ucgacugucuu cucu cacucgugcgu gucg uc gacg                            a
   u  u  --   c  u -           u    u           u    -  -    cggauccggauccgauccguagguagcu 
Get sequence
Deep sequencing
203983 reads, 2.06e+05 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 185613978-185614144 [-]
Database links

Mature sequence zma-miR156f-5p

Accession MIMAT0001352
Previous IDszma-miR156f

21 - 


 - 40

Get sequence
Deep sequencing203816 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR156f-3p

Accession MIMAT0015125
Previous IDszma-miR156f*

131 - 


 - 152

Get sequence
Deep sequencing154 reads, 2 experiments
Evidence experimental; Illumina [2]


"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).