Stem-loop sequence zma-MIR156d

AccessionMI0001456 (change log)
DescriptionZea mays miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

51 open access papers mention zma-MIR156d
(342 sentences)

Stem-loop
   a    c        ------         -    -        a     -c    aacg      
5'  ggcu ucgagaga      uugacagaa gaga gugagcac cggcg  gacg    acaua 
    |||| ||||||||      ||||||||| |||| |||||||| |||||  ||||    |||| g
3'  ucgg agcucucu      gacugucuu cucu cacucgug gccgc  cugc    uguac 
   -    u        uucucc         u    u        c     uc    cgua      
Get sequence
Deep sequencing
217228 reads, 9.22e+03 reads per million, 210 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 94725847-94725965 [-]
intergenic
Database links

Mature sequence zma-miR156d-5p

Accession MIMAT0001351
Previous IDszma-miR156d
Sequence

16 - 

ugacagaagagagugagcac

 - 35

Get sequence
Deep sequencing214582 reads, 207 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR156d-3p

Accession MIMAT0015124
Previous IDszma-miR156d*
Sequence

80 - 

gcucacuucucuuucugucagc

 - 101

Get sequence
Deep sequencing1396 reads, 165 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).