Stem-loop sequence hsa-mir-425

AccessionMI0001448
Symbol HGNC:MIR425
DescriptionHomo sapiens miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
        c  u    aau       u  c     u  a  -----  g 
5' gaaag gc uugg   gacacga ca ucccg ug gu     gg c
   ||||| || ||||   ||||||| || ||||| || ||     ||  
3' cuuuc cg gacc   cugugcu gu agggc ac cg     cc a
        u  u    cgc       -  a     u  -  aagag  c 
Get sequence
Deep sequencing
17676 reads, 2.44e+03 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequences were previously named miR-425-5p and miR-425-3p in [2] and here. Landgraf et al. show that the 5' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr3: 49020148-49020234 [-]
sense
OTTHUMT00000345432 ; RP13-131K19.1-001; intron 1
OTTHUMT00000345433 ; RP13-131K19.1-002; intron 1
ENST00000415982 ; RP13-131K19.1-001; intron 1
ENST00000429681 ; RP13-131K19.1-002; intron 1
antisense
OTTHUMT00000345437 ; ARIH2-034; exon 1
OTTHUMT00000345252 ; ARIH2-006; intron 13
OTTHUMT00000257525 ; ARIH2-001; intron 14
OTTHUMT00000345248 ; ARIH2-002; intron 15
ENST00000487891 ; ARIH2-034; exon 1
ENST00000452385 ; ARIH2-006; intron 13
ENST00000356401 ; ARIH2-001; intron 14
ENST00000449376 ; ARIH2-002; intron 15
Clustered miRNAs
< 10kb from hsa-mir-425
hsa-mir-191chr3: 49020618-49020709 [-]
hsa-mir-425chr3: 49020148-49020234 [-]
Database links

Mature sequence hsa-miR-425-5p

Accession MIMAT0003393
Previous IDshsa-miR-425-5p;hsa-miR-425
Sequence

14 - 

aaugacacgaucacucccguuga

 - 36

Get sequence
Deep sequencing5567 reads, 64 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-425-3p

Accession MIMAT0001343
Previous IDshsa-miR-425;hsa-miR-425-3p;hsa-miR-425*
Sequence

55 - 

aucgggaaugucguguccgccc

 - 76

Get sequence
Deep sequencing2752 reads, 61 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).