Stem-loop sequence mmu-mir-425

AccessionMI0001447 (change log)
Symbol MGI:Mir425
DescriptionMus musculus miR-425 stem-loop
Gene family MIPF0000242; mir-425
Stem-loop
       u  u    aau       u  c     u  ----ag   g 
5' aaag gc uugg   gacacga ca ucccg ug      ugg c
   |||| || ||||   ||||||| || ||||| ||      |||  
3' uuuc cg gacc   cugugcu gu agggc ac      acc a
       u  u    cgc       -  a     u  cgaaga   c 
Get sequence
Deep sequencing
81363 reads, 439 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 108568777-108568861 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-425
mmu-mir-191chr9: 108568319-108568392 [+]
mmu-mir-425chr9: 108568777-108568861 [+]
Database links

Mature sequence mmu-miR-425-5p

Accession MIMAT0004750
Previous IDsmmu-miR-425
Sequence

13 - 

aaugacacgaucacucccguuga

 - 35

Get sequence
Deep sequencing69241 reads, 76 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-425-3p

Accession MIMAT0001342
Previous IDsmmu-miR-425;mmu-miR-425*
Sequence

54 - 

aucgggaaugucguguccgcc

 - 74

Get sequence
Deep sequencing12118 reads, 74 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).