Stem-loop sequence hsa-mir-424

Accession MI0001446
Symbol HGNC:MIR424
Description Homo sapiens miR-424 stem-loop
Gene family MIPF0000164; mir-322
Stem-loop 
---------------------       a  c      aa             g   u 
                     cgagggg ua agcagc  uucauguuuugaa ugu c
                     ||||||| || ||||||  ||||||||||||| ||| u
                     gcucccc au ucgucg  gagugcaaaacuu gua a
gggguggaagauggaaggggu       c  a      cg             g   a
Get sequence
Deep sequencing
12458 reads, 54 experiments
Comments

This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells [1]. The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MI0000589 ), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 133680644-133680741 [-]
sense
OTTHUMT00000058369 ; AC004383.4-001; exon 1
OTTHUMT00000058370 ; AC004383.4-002; exon 1
OTTHUMT00000058372 ; AC004383.4-004; exon 1
OTTHUMT00000058370 ; AC004383.4-002; exon 1
OTTHUMT00000058372 ; AC004383.4-004; exon 1
OTTHUMT00000058369 ; AC004383.4-001; exon 1
ENST00000441492 ; AC004383.4-001; exon 1
ENST00000440570 ; AC004383.4-002; exon 1
ENST00000414769 ; AC004383.4-004; exon 1
ENST00000440570 ; AC004383.4-002; exon 1
ENST00000414769 ; AC004383.4-004; exon 1
ENST00000441492 ; AC004383.4-001; exon 1
Clustered miRNAs
< 10kb from hsa-mir-424
hsa-mir-424 chrX: 133680644-133680741 [-]
hsa-mir-503 chrX: 133680358-133680428 [-]
hsa-mir-542 chrX: 133675371-133675467 [-]
hsa-mir-450a-2 chrX: 133674538-133674637 [-]
hsa-mir-450a-1 chrX: 133674371-133674461 [-]
hsa-mir-450b chrX: 133674215-133674292 [-]
Database links

Mature sequence hsa-miR-424-5p

Accession MIMAT0001341
Previous IDs hsa-miR-424
Sequence

11 -  

cagcagcaauucauguuuugaa

 - 32

Get sequence
Deep sequencing 9902 reads, 35 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-424-3p

Accession MIMAT0004749
Previous IDs hsa-miR-424*
Sequence

48 -  

caaaacgugaggcgcugcuau

 - 68

Get sequence
Deep sequencing 2548 reads, 33 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).