Stem-loop sequence hsa-mir-424

AccessionMI0001446 (change log)
Symbol HGNC:MIR424
DescriptionHomo sapiens miR-424 stem-loop
Gene family MIPF0000164; mir-322
   ---------------------       a  c      aa             g   u 
5'                      cgagggg ua agcagc  uucauguuuugaa ugu c
                        ||||||| || ||||||  ||||||||||||| ||| u
3'                      gcucccc au ucgucg  gagugcaaaacuu gua a
   gggguggaagauggaaggggu       c  a      cg             g   a 
Get sequence
Deep sequencing
768614 reads, 7.62e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

This hairpin precursor expresses a 5' arm product, named miR-424, in human promyelocytic leukemia (HL-60) cells [1]. The level of expression of miR-424 was shown to be up-regulated 48 hours after TPA-induction. The sequence is orthologous to the experimentally verified rat miR-322 locus (MI0000589), which expresses its mature product from the 3' arm of the hairpin. The human miR-424 hairpin does not appear to contain the miR-322 sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 134546614-134546711 [-]
Clustered miRNAs
< 10kb from hsa-mir-424
hsa-mir-424chrX: 134546614-134546711 [-]
hsa-mir-503chrX: 134546328-134546398 [-]
hsa-mir-542chrX: 134541341-134541437 [-]
hsa-mir-450a-2chrX: 134540508-134540607 [-]
hsa-mir-450a-1chrX: 134540341-134540431 [-]
hsa-mir-450bchrX: 134540185-134540262 [-]
Database links

Mature sequence hsa-miR-424-5p

Accession MIMAT0001341
Previous IDshsa-miR-424

11 - 


 - 32

Get sequence
Deep sequencing741281 reads, 77 experiments
Evidence experimental; cloned [1-2], Northern [1]
Database links
Predicted targets

Mature sequence hsa-miR-424-3p

Accession MIMAT0004749
Previous IDshsa-miR-424*

48 - 


 - 68

Get sequence
Deep sequencing27301 reads, 77 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets


PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).